2024 Probable glycosyltransferase

Probable glycosyltransferase

Author: ahsu

August undefined, 2024

WebbSearch Result : 3486 hits Entry KO len SW-score(margin) bits identity overlap best(all) ----- ----- maf:MAF_16470 putative conserved transmembrane protein K14340 556 3719 ( 3565) 854 1.000 556 <-> 4 mbk:K60_017180 transmembrane protein K14340 556 3719 ( 3564) 854 1.000 556 <-> 4 mbm:BCGMEX_1645c putative membrane protein K14340 556 3719 … WebbEC_v6.g098075 probable L-ascorbate peroxidase 6 F: GACCTCTTTCAGCTTGCCAG R: TCCTTGTCATTCAGGCCCAT 195 EC_v6.g107834 peroxidase A2-like F: ... -Glycosyltransferase superfamily 4.85 3.91 3.42 3.12 2.53 2.36 1.96 EC_v6.g031559 UDP-Glycosyltransferase superfamilyGlycosyltransferase superfamily protein [Zea mays]

KEGG SSDB Best Search Result: xcb:XC_1473

WebbNational Center for Biotechnology Information WebbThe Pfam website will be decommissioned in January 2024. You will be redirected in 4 seconds to the corresponding data page on the InterPro website. 4. The URL below is … portland area homes

Glycosyltransferases - Sigma-Aldrich

WebbMatch: Q9LN68 (Probable galacturonosyltransferase-like 1 OS=Arabidopsis thaliana OX=3702 GN=GATL1 PE=2 SV=1) HSP 1 Score: 531.2 bits (1367), ... GLYCOSYLTRANSFERASE 8 DOMAIN-CONTAINING PROTEIN: coord: 18..352: Relationships. The following mRNA feature(s) are a part of this gene: Feature Name … WebbMatch: GT11_ARATH (Probable xyloglucan galactosyltransferase GT11 OS=Arabidopsis thaliana GN=GT11 PE=2 SV=1) HSP 1 Score: 335.1 bits (858), ... EXOSTOSIN HEPARAN … Webb11 nov. 2015 · 1 Molecular Parasitology Division, New England Biolabs, Beverly, Massachusetts, United States of America,2 National Center for Biotechnology Information, Nation ... ,干细胞之家 - 中国干细胞行业门户第一站 portland area hospitals rated

ASM3 protein (Candida albicans SC5314) - STRING interaction …

WebbGene ID: 101775721, updated on 28-Aug-2024. Summary Other designations. probable glycosyltransferase 2, putative glycosyltransferase 5, putative glycosyltransferase 5 WebbSearch Result : 2494 hits Entry KO len SW-score(margin) bits identity overlap best(all) ----- ----- xcc:XCC2644 conserved hypothetical protein 215 1453 ( 1342) 337 1.000 215 <-> 4 xcp:XCR_2995 conserved hypothetical protein 215 1413 ( 1303) 328 0.963 215 <-> 3 xar:XB05_08895 hypothetical protein 215 1101 ( 978) 257 0.721 215 <-> 6 … portland area homes for saleWebbHyperosmolality-gated calcium-permeable channels (OSCA) are characterized as an osmosensor in plants; they are able to recognize and respond to exogenous and endogenous osmotic changes, and play a vital role in plant growth and adaptability to environmental stress. To explore the potential biological functions of OSCAs in maize, … portland area honda dealerships

"Webb23 jan. 2024 · probable glycosyltransferase At5g03795 Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. … " - Probable glycosyltransferase

Probable glycosyltransferase

Csa5G171710 (gene) Cucumber (Chinese Long) v2 Cucurbit …

WebbSe han realizado investigaciones en laboratorio y en campo para evaluar su capacidad para fijar nitrógeno y su efecto en la salud humana y animal. A medida que se descubren más propiedades y usos potenciales de esta bacteria, es probable que se realicen más investigaciones en el futuro. Referencias Yamada, R., Itakura, M., & Singh, R. P. (2013). Webb15 juni 2024 · Future directions. The study of glycosyltransferase enzymes and glycosylated molecules is still a technically challenging field. As new analytic tools …

Did you know?

Webb30 mars 2024 · Tailford LE, Crost EH, Kavanaugh D, Juge N. Mucin glycan foraging in the human gut microbiome. Front Genet. 2015 Mar 19;6:81. doi: 10.3389/fgene.2015.00081 ... WebbThis enzyme exhibits both glycosyltransferase and amylo-1,6-glucosidase activities on a single polypeptide chain [ 39 ]. Using the transferase activity, the debranching enzyme transfers the three glucose residues from the four-residue glycogen branch to …

WebbSearch Result : 457 hits Entry KO len SW-score(margin) bits identity overlap best(all) ----- ----- ipc:IPA_01225 hypothetical protein 164 560 ( 334) 133 0.537 164 <-> 2 pdl:Pyrde_1397 hypothetical protein K07013 190 547 ( -) 131 0.507 150 <-> 1 iho:Igni_0581 4-vinyl reductase, 4VR K07013 152 272 ( -) 68 0.381 139 <-> 1 trd:THERU_00580 4-vinyl … Webb22 juni 2024 · Flesh firmness of watermelon is an important quality trait for commercial fruit values, including fruit storability, transportability, and shelf life. To date, knowledge …

WebbList Of Proteins; Protein Name Family Reference Accession; β-1,3-galactofuranosyltransferase (Lpg1;LmjF25.0010) GT40: CAJ04354.1: chitinase … Webbprobable glycosyltransferase At3g42180 Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. LOC104089134 probable …

WebbMatch: XP_004148897.2 (PREDICTED: probable galacturonosyltransferase-like 4 [Cucumis sativus] >KGN44858.1 hypothetical protein Csa_7G392310 [Cucumis sativus]) ... GLYCOSYLTRANSFERASE 8 DOMAIN-CONTAINING PROTEIN: coord: 24..367: None: No IPR available: PANTHER: PTHR13778:SF5: GALACTURONOSYLTRANSFERASE-LIKE 4 …

Webbprobable glycosyltransferase BF0814 (Q23107920) From Wikidata. Jump to navigation Jump to search. microbial gene found in Bacteroides fragilis YCH46. BF0814; probable … optical parts of the eyeWebbMatch: XP_004141952.2 (PREDICTED: probable galacturonosyltransferase-like 1 [Cucumis sativus] >KGN48449.1 Glycosyltransferase family GT8 protein [Cucumis sativus]) HSP 1 … portland area hotelsWebb3 juni 2024 · probable glycosyltransferase At5g03795 Gene provides a unified query environment for genes defined by sequence and/or in NCBI's Map Viewer. … optical patch cordWebbMatch: XP_022984051.1 (probable galacturonosyltransferase-like 7 [Cucurbita maxima] >XP_022984052.1 probable galacturonosyltransferase-like 7 [Cucurbita maxima]) ... GLYCOSYLTRANSFERASE 8 DOMAIN-CONTAINING PROTEIN: coord: 1..365: Synteny The following gene(s) are orthologous to this gene: Gene Orthologue Organism Block; optical path simulationWebbReturn to Gene Family Index. General comments or questions: [email protected]@arabidopsis.org optical parts of microscopeWebb9 juli 2024 · A glycosyltransferase activity assay provides a means of which to thoroughly interrogate GT targets for novel treatments. From a drug discovery point of view, GTs are … optical people hinckley reviewWebb11 apr. 2024 · HIGHLIGHTS. who: Nat. Hazards Earth Syst. and collaborators from the of Geography, University of Zurich, Zurich, Switzerland have published the article: Comprehensive space-time hydrometeorological simulations for estimating very rare floods at multiple sites in a large river basin, in the Journal: (JOURNAL) of 86,/06/1987 … portland area hospitals